View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11415_low_1 (Length: 549)
Name: NF11415_low_1
Description: NF11415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11415_low_1 |
 |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 319
Target Start/End: Complemental strand, 17245416 - 17245114
Alignment:
| Q |
17 |
acatagatgatgccatattgagttactagggatgttatccttggttgatcagaaggtggataaaaggaaagaatcaatggtggcttgttcaatagaagca |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17245416 |
acataggtgatgccatattgagttactagggatgttatccttggatgatcagaaggtggataaaaggaaagaatcaatggtggcttgttcaatagaagca |
17245317 |
T |
 |
| Q |
117 |
tgccttcaacataatctgctccattggagtcatttcttctattgaatgagattaaatgttcttgatctgtggaaaatgcagaaaagtcgttgtaaattag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17245316 |
tgccttcaacataatctgctccattggagtcatttcttctatcaaatgagattaaatgttcttgatctgtggaaaatgcggaaaagtcgttgtaaattag |
17245217 |
T |
 |
| Q |
217 |
acgcaaccactttacctgcaaacaatcaaacaaagatacgttgagcttatttatggatggaaaattctatggtgaagtcgtaagaatgacttttctggta |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17245216 |
acgcaaccactttacctgcaaacaatcaaacaaagatctgttgagcttatttatggatggaaaattctatggtgaagtcgcgagaatgacttttctggta |
17245117 |
T |
 |
| Q |
317 |
aag |
319 |
Q |
| |
|
||| |
|
|
| T |
17245116 |
aag |
17245114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 180; E-Value: 6e-97
Query Start/End: Original strand, 316 - 542
Target Start/End: Complemental strand, 17244743 - 17244516
Alignment:
| Q |
316 |
aaaggttattattgaaccgcaactttgataaggaattcatgtcacggagnnnnnnnn-ctttctcaattgattattgatagttttaaacatacatatgtg |
414 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17244743 |
aaaggttattattgaaccgcaactttcataaggaattcatgtcacggagattttttttctttcacaattgattattgatagttttaaacatacatatgtg |
17244644 |
T |
 |
| Q |
415 |
tgaatgaaaaagagatgataatacttgccctagttggtgcaggtccaagaagtattcttgctctggttatcactccaaattgacctagtcctccaagaac |
514 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17244643 |
tgaacgaaaaagagatgataatacttgccctagttggtgcaggtccaagaagtattcttgctctggttatcactccaaattgacctagtcctccaagaac |
17244544 |
T |
 |
| Q |
515 |
ggcataaaacacctctgagttcttctct |
542 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
17244543 |
ggcataaaatacctctgagttcttctct |
17244516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 273 - 319
Target Start/End: Original strand, 22963398 - 22963444
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22963398 |
atggaaaattttatggtgaagtcataagaatgacttttctggtaaag |
22963444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 273 - 319
Target Start/End: Complemental strand, 22998079 - 22998033
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22998079 |
atggaaaattttatggtgaagtcataagaatgacttttctggtaaag |
22998033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 315
Target Start/End: Original strand, 19313850 - 19313892
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19313850 |
atggaaaattctatggtgaagtcattagaatgacttttctggt |
19313892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 315
Target Start/End: Original strand, 33902066 - 33902108
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
33902066 |
atggaaaattctatgatgaagtcgttagaatgacttttctggt |
33902108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 41465508 - 41465549
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
41465508 |
tggaaaattctatggtgaagtcatgagaatgacttttctggt |
41465549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 4264280 - 4264236
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
4264280 |
ggaaaattctatggtgaagtcatcataatgacttttctggtaaag |
4264236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 276 - 315
Target Start/End: Original strand, 13711465 - 13711504
Alignment:
| Q |
276 |
gaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
13711465 |
gaaaattctatggtgaagtcatcagaatgacttttctggt |
13711504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 277 - 315
Target Start/End: Original strand, 36641988 - 36642026
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
36641988 |
aaaattctatggtgaagtcatgagaatgacttttctggt |
36642026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 312
Target Start/End: Complemental strand, 39788625 - 39788588
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
39788625 |
ggaaaattttatggtgaagtcataagaatgacttttct |
39788588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 11366584 - 11366544
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
11366584 |
ggaaaattctatggtgaaatcataagaatgacttttttggt |
11366544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 34441969 - 34441925
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||||||| | | |||||||||| |||||||| |
|
|
| T |
34441969 |
ggaaaattctatggtgaagtcatgaaaatgacttttttggtaaag |
34441925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 9e-16; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 450 - 541
Target Start/End: Original strand, 52451917 - 52452008
Alignment:
| Q |
450 |
ggtgcaggtccaagaagtattcttgctctggttatcactccaaattgacctagtcctccaagaacggcataaaacacctctgagttcttctc |
541 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||| | |||||||| ||||| ||||||||||| |||||||| | |||||||||||||| |
|
|
| T |
52451917 |
ggtgcaggtccaagagctattcttgctcgggttataatcccaaattggcctagacctccaagaaccgcataaaataattctgagttcttctc |
52452008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 161 - 233
Target Start/End: Original strand, 52451509 - 52451581
Alignment:
| Q |
161 |
aatgagattaaatgttcttgatctgtggaaaatgcagaaaagtcgttgtaaattagacgcaaccactttacct |
233 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||| || ||| | ||||||||||| |
|
|
| T |
52451509 |
aatgagattaaatgttcttggtctccagaaaatgcagagaagtcgttgtaaagtaaacggagccactttacct |
52451581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 272 - 315
Target Start/End: Complemental strand, 28003200 - 28003157
Alignment:
| Q |
272 |
gatggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
28003200 |
gatggaaaattctatggtgaagtcatgagaatgacttttctggt |
28003157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 17272011 - 17272051
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17272011 |
ggaaaattctatggtgaagtcgtgggaatgacttttctggt |
17272051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 29584409 - 29584369
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29584409 |
ggaaaattctatggtgaagtcgtgggaatgacttttctggt |
29584369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 32912791 - 32912751
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
32912791 |
ggaaaattctatggtgaagtcataagaatgacttttttggt |
32912751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 34361702 - 34361662
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
34361702 |
ggaaaattctatggtgaagtcataagaatgacttttttggt |
34361662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 38812308 - 38812268
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
38812308 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
38812268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 275 - 310
Target Start/End: Complemental strand, 37663950 - 37663915
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgactttt |
310 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37663950 |
ggaaaattctatggtgaagtcataagaatgactttt |
37663915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 276 - 315
Target Start/End: Original strand, 51204580 - 51204619
Alignment:
| Q |
276 |
gaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
51204580 |
gaaaattctatggtgaagtcataaaaatgacttttctggt |
51204619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 312
Target Start/End: Complemental strand, 55241317 - 55241278
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
55241317 |
atggaaaattctatggtgaagtcatgagaatgacttttct |
55241278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 277 - 315
Target Start/End: Complemental strand, 20097537 - 20097499
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
20097537 |
aaaattctatggtgaagtcatgagaatgacttttctggt |
20097499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 277 - 315
Target Start/End: Original strand, 27396618 - 27396656
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
27396618 |
aaaattctatggtgaagtcatgagaatgacttttctggt |
27396656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 273 - 315
Target Start/End: Original strand, 38811811 - 38811853
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
38811811 |
atggaaaattctatggtgaagtcatgagaatgatttttctggt |
38811853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 273 - 315
Target Start/End: Original strand, 39397916 - 39397958
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
39397916 |
atggaaaattctatggtgaagtcattagaatgacttttatggt |
39397958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 7152317 - 7152273
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
7152317 |
ggaaaattctatggtgaagtcatgctaatgacttttctggtaaag |
7152273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 35021246 - 35021206
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
35021246 |
ggaaaattctatggtgaagtcatgaaaatgacttttctggt |
35021206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 38011854 - 38011894
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
38011854 |
ggaaaattctatggtgaaatcatgagaatgacttttctggt |
38011894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 19631749 - 19631789
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19631749 |
ggaaaattctatggtgaagtcataagaatgacttttctggt |
19631789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 8513233 - 8513273
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
8513233 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
8513273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 276 - 315
Target Start/End: Original strand, 20768087 - 20768126
Alignment:
| Q |
276 |
gaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
20768087 |
gaaaattctatggtgaagtcatgagaatgacttttctggt |
20768126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 277 - 315
Target Start/End: Complemental strand, 30353540 - 30353502
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
30353540 |
aaaattctatggtgaagtcatgagaatgacttttctggt |
30353502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 278 - 315
Target Start/End: Original strand, 25440961 - 25440998
Alignment:
| Q |
278 |
aaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
25440961 |
aaattctatggtgaagtcgttaaaatgacttttctggt |
25440998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 3880123 - 3880083
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3880123 |
ggaaaattctatggtgaagtcacgagaatgacttttctggt |
3880083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 4319007 - 4318967
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
4319007 |
ggaaaattctatggtgaagtcatgagaatgacttttttggt |
4318967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 5627391 - 5627431
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
5627391 |
ggaaaattctaaggtgaagtcataagaatgacttttttggt |
5627431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 11084200 - 11084156
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||||||| | | ||| ||||||||||||||| |
|
|
| T |
11084200 |
ggaaaattctatggtgaagtcatgaaaataacttttctggtaaag |
11084156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 272 - 318
Target Start/End: Complemental strand, 10359403 - 10359357
Alignment:
| Q |
272 |
gatggaaaattctatggtgaagtcgtaagaatgacttttctggtaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
10359403 |
gatggaaaattctatggtgaagtcatgataatgacttttctggtaaa |
10359357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 272 - 312
Target Start/End: Complemental strand, 5657670 - 5657630
Alignment:
| Q |
272 |
gatggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
5657670 |
gatggaaaattctatggtgaagtcatgagaatgacttttct |
5657630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 26524513 - 26524473
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
26524513 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
26524473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 312
Target Start/End: Original strand, 8861258 - 8861297
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8861258 |
atggaaaattctatggtgaagtcatgagaatgacttttct |
8861297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 276 - 315
Target Start/End: Original strand, 24211717 - 24211756
Alignment:
| Q |
276 |
gaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
24211717 |
gaaaattctatggtgaagtcataagaatgacttttttggt |
24211756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 275 - 310
Target Start/End: Original strand, 30055501 - 30055536
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgactttt |
310 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30055501 |
ggaaaattctatggtgaagtcataagaatgactttt |
30055536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 274 - 312
Target Start/End: Original strand, 6546493 - 6546531
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
6546493 |
tggaaaattctatggtgaagtcataagaatgatttttct |
6546531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 273 - 315
Target Start/End: Complemental strand, 23402421 - 23402379
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
23402421 |
atggaaaattctatggcgaagtcatgagaatgacttttctggt |
23402379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 12165726 - 12165767
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
12165726 |
tggaaaattctacggtgaagtcgttaaaatgacttttctggt |
12165767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 37109846 - 37109887
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
37109846 |
tggaaaattctatggtgaagtcataaaaatgacttttttggt |
37109887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 17842772 - 17842732
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
17842772 |
ggaaaattctatggtgaagtcataaaaatgacttttttggt |
17842732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 18797304 - 18797344
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
18797304 |
ggaaaattctatggtgaagtcatgagaatgacttttttggt |
18797344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 41765264 - 41765220
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||| ||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
41765264 |
ggaaaattccatggtgaagtcatgagaatgacttttctgataaag |
41765220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 277 - 319
Target Start/End: Complemental strand, 25501099 - 25501057
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
25501099 |
aaaattctatggtgaagtcatgagaatgacttttctggtaaag |
25501057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 8742062 - 8742022
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
8742062 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
8742022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 27330306 - 27330346
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27330306 |
ggaaaattctatggtgaagtcgtgggaatgacttttctggt |
27330346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 273 - 315
Target Start/End: Complemental strand, 14409503 - 14409461
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
14409503 |
atggaaaattctatggtgaagtcatgagaatgatttttctggt |
14409461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 7693229 - 7693270
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
7693229 |
tggaaaattctatggtgaagtcattaaaatgacttttctggt |
7693270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 312
Target Start/End: Original strand, 39572819 - 39572856
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39572819 |
ggaaaattctatggtgaagtcatgagaatgacttttct |
39572856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 19119859 - 19119899
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
19119859 |
ggaaaattctatggtgaagtcatgagaatgacttttgtggt |
19119899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 22616494 - 22616534
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
22616494 |
ggaaaattctatggtgaagtcatgaaaatgacttttctggt |
22616534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 25513771 - 25513811
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
25513771 |
ggaaaattctatggtgaagtcgttaaaatgatttttctggt |
25513811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 319
Target Start/End: Original strand, 3309142 - 3309188
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
3309142 |
atggaaaattctatggtaaagtcatgagaatgacttttctggtaaag |
3309188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 38823209 - 38823250
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
38823209 |
tggaaaattctatggtgaagtcatgagaatgacttttctggt |
38823250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 1547283 - 1547323
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1547283 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
1547323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 274 - 312
Target Start/End: Original strand, 43579241 - 43579279
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttct |
312 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
43579241 |
tggaaaattctatggtgaagtcatgagaatgacttttct |
43579279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 4150535 - 4150495
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
4150535 |
ggaaaattctatggtgaagtcatgataatgacttttctggt |
4150495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 16415641 - 16415681
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
16415641 |
ggaaaattctaaggtgaagtcatgagaatgacttttctggt |
16415681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 18422647 - 18422687
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
18422647 |
ggaaaattctatggtgaagtcataaaaatgacttttttggt |
18422687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 37619076 - 37619036
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
37619076 |
ggaaaattctatggtgaagttataagaatgacttttttggt |
37619036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000008; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 15009240 - 15009281
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15009240 |
tggaaaattctatggtgaagtcataagaatgacttttttggt |
15009281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 1150296 - 1150256
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
1150296 |
ggaaaattctatggtgaagtcataagaatgacttttttggt |
1150256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 7998362 - 7998402
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
7998362 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
7998402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 275 - 313
Target Start/End: Complemental strand, 39099300 - 39099262
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctg |
313 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
39099300 |
ggaaaattctatggtgaagtcatgagaatgacttttctg |
39099262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 13307621 - 13307662
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
13307621 |
tggaaaattctatggtgaagtcatgagaatgatttttctggt |
13307662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 1835437 - 1835397
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||| |
|
|
| T |
1835437 |
ggaaaattctatggtgaagttgttagaatgacttttttggt |
1835397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 1879278 - 1879238
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||| |
|
|
| T |
1879278 |
ggaaaattctatggtgaagttgttagaatgacttttttggt |
1879238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 274 - 310
Target Start/End: Complemental strand, 5300138 - 5300102
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgactttt |
310 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5300138 |
tggaaaattctatggtgaagtcatgagaatgactttt |
5300102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 16447066 - 16447022
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||| ||||| |
|
|
| T |
16447066 |
ggaaaattctatggtgaagtcatgaaaatgacttttctgataaag |
16447022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 27083029 - 27082989
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
27083029 |
ggaaaattctatggtgaagtcatcagactgacttttctggt |
27082989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000003; HSPs: 12)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 273 - 313
Target Start/End: Original strand, 4015449 - 4015489
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctg |
313 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
4015449 |
atggaaaattctatggtgaagtcatgagaatgacttttctg |
4015489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 40640682 - 40640642
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
40640682 |
ggaaaattctatggtgaagtcatgagaatgacttttctggt |
40640642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 273 - 313
Target Start/End: Original strand, 42204340 - 42204380
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctg |
313 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
42204340 |
atggaaaattctatcgtgaagtcgtgagaatgacttttctg |
42204380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 275 - 319
Target Start/End: Complemental strand, 45879546 - 45879502
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggtaaag |
319 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
45879546 |
ggaaaattctatgctgaagtcatgagaatgacttttctggtaaag |
45879502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 275 - 313
Target Start/End: Original strand, 11466815 - 11466853
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctg |
313 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
11466815 |
ggaaaattctatggtgaagtcttgagaatgacttttctg |
11466853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 274 - 315
Target Start/End: Complemental strand, 51213167 - 51213126
Alignment:
| Q |
274 |
tggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
51213167 |
tggaaaattctatggtgaagtcatgagaatgacttttttggt |
51213126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 21193597 - 21193637
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||| ||||| | ||||||||||||||||| |
|
|
| T |
21193597 |
ggaaaattctatggtaaagtcatgagaatgacttttctggt |
21193637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 22450959 - 22450999
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
22450959 |
ggaaaattctatggtgaagtcatgagaatgatttttctggt |
22450999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 26941445 - 26941405
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
26941445 |
ggaaaattctatggtgaagtcataagaatgatttttttggt |
26941405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 35844317 - 35844357
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
35844317 |
ggaaaattctatggtgaagtcatgataatgacttttctggt |
35844357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 46994835 - 46994795
Alignment:
| Q |
275 |
ggaaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
46994835 |
ggaaaattctacggtgaagtcgtaagaatgatttttttggt |
46994795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 273 - 313
Target Start/End: Complemental strand, 53812026 - 53811986
Alignment:
| Q |
273 |
atggaaaattctatggtgaagtcgtaagaatgacttttctg |
313 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
53812026 |
atggaaaattctacggtgaagtcatgagaatgacttttctg |
53811986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 277 - 315
Target Start/End: Original strand, 43959 - 43997
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
43959 |
aaaattctatggtgaagtcgtaagaaagacttttttggt |
43997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 277 - 315
Target Start/End: Complemental strand, 154828 - 154790
Alignment:
| Q |
277 |
aaaattctatggtgaagtcgtaagaatgacttttctggt |
315 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
154828 |
aaaattctatggtgaagtcgtaagaaagacttttttggt |
154790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University