View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11416_high_7 (Length: 250)
Name: NF11416_high_7
Description: NF11416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11416_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 10)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 30827130 - 30827372
Alignment:
| Q |
1 |
caaggcataacaaatgattataaagatatttggtaatactagcagcttgtgacacaactacttcaacttcttccaactttgattttgcacttgatcacaa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30827130 |
caaggcataacaa-tgattataaagatatttagtaatactagcagcttgtgacacaactacttcaacttcttccaactttgattttgcacttgatcacaa |
30827228 |
T |
 |
| Q |
101 |
gatctcatattgatctccttgagttgtgtgcatttttgaacgacatgattcgctcccttctctgtgacatcagtacaatagctcaaatcaagcacctcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30827229 |
gatctcatattgatctccttgagttgtgtgcatttttgaacgacatgattcgctcccttctctgtgacatccgtacaatagctcaaatcaagcacctcca |
30827328 |
T |
 |
| Q |
201 |
aattggggaaaatagaagtaaacaataggatgttttcatctctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30827329 |
aattggggaaaatagaagtaaacaataggatgttttcatctctc |
30827372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 244
Target Start/End: Original strand, 33160702 - 33160769
Alignment:
| Q |
177 |
aatagctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||| |||||||| |||||||||||||||| |
|
|
| T |
33160702 |
aatagctcaaatcaagcacctccaaattggggaacatgaaaggaaacaatacgatgttttcatctctc |
33160769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 29658867 - 29658799
Alignment:
| Q |
176 |
caatagctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctctc |
244 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |||| |||||||| |||||||| ||||||| |
|
|
| T |
29658867 |
caatagctcaaatcaagcacttccaagttggggaaaatggaagcaaacaatatgatgttttgatctctc |
29658799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 29691382 - 29691314
Alignment:
| Q |
176 |
caatagctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||| |||||||| ||||||| ||||||| |
|
|
| T |
29691382 |
caatagctcaaatcaagcacctccaagttggggaaaatggaagcaaacaatataatgttttgatctctc |
29691314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 29718894 - 29718826
Alignment:
| Q |
176 |
caatagctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||| |||||||| ||||||| ||||||| |
|
|
| T |
29718894 |
caatagctcaaatcaagcacctccaagttggggaaaatggaagcaaacaatataatgttttgatctctc |
29718826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 88 - 170
Target Start/End: Complemental strand, 29659108 - 29659026
Alignment:
| Q |
88 |
cacttgatcacaagatctcatattgatctccttgagttgtgtgcatttttgaacgacatgattcgctcccttctctgtgacat |
170 |
Q |
| |
|
||||||||||||| |||||| ||||||||| | ||||| ||||| |||||||| ||||| || |||| ||||||||||||| |
|
|
| T |
29659108 |
cacttgatcacaatatctcaaattgatctcagtcagttgcgtgcagttttgaaccacatgttttactccattctctgtgacat |
29659026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 240
Target Start/End: Complemental strand, 19468397 - 19468340
Alignment:
| Q |
183 |
tcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatc |
240 |
Q |
| |
|
|||||||||||| || ||||||||| ||||| |||| ||||| || |||||||||||| |
|
|
| T |
19468397 |
tcaaatcaagcagctgcaaattgggaaaaatggaagcaaacattatgatgttttcatc |
19468340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 243
Target Start/End: Original strand, 9581276 - 9581332
Alignment:
| Q |
187 |
atcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctct |
243 |
Q |
| |
|
|||||||| || ||||||||||||||| |||| ||||| || |||||||| |||||| |
|
|
| T |
9581276 |
atcaagcagctgcaaattggggaaaattgaagcaaacattatgatgtttttatctct |
9581332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 243
Target Start/End: Original strand, 9586844 - 9586900
Alignment:
| Q |
187 |
atcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctct |
243 |
Q |
| |
|
|||||||| || ||||||||||||||| |||| ||||| || |||||||| |||||| |
|
|
| T |
9586844 |
atcaagcagctgcaaattggggaaaattgaagcaaacattatgatgtttttatctct |
9586900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 29719121 - 29719053
Alignment:
| Q |
102 |
atctcatattgatctccttgagttgtgtgcatttttgaacgacatgattcgctcccttctctgtgacat |
170 |
Q |
| |
|
|||||| |||||||||| | ||||| |||| |||||||| ||||| ||| |||| ||||||||||||| |
|
|
| T |
29719121 |
atctcaaattgatctccctcagttgcttgcagttttgaaccacatgtttcactccattctctgtgacat |
29719053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 6594505 - 6594446
Alignment:
| Q |
182 |
ctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatct |
241 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
6594505 |
ctcaaatcaagcagctccaaagtggggaaaatagaagcaaacaatatgatgttttcatct |
6594446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 10634341 - 10634273
Alignment:
| Q |
174 |
tacaatagctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatctc |
242 |
Q |
| |
|
||||||| |||||||| ||||| ||||| ||||| ||||| ||||||||||| | ||||| |||||||| |
|
|
| T |
10634341 |
tacaataactcaaatccagcacgtccaagttgggaaaaatggaagtaaacaacatgatgtgttcatctc |
10634273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 239
Target Start/End: Complemental strand, 55908626 - 55908567
Alignment:
| Q |
180 |
agctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcat |
239 |
Q |
| |
|
||||||||||||| | | ||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
55908626 |
agctcaaatcaagaaattgcaaattggggaaaatggaagcaaacaatatgatgttttcat |
55908567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 240
Target Start/End: Original strand, 570542 - 570606
Alignment:
| Q |
176 |
caatagctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcatc |
240 |
Q |
| |
|
||||| || |||||||| | || |||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
570542 |
caataacttaaatcaagtatctgcaaattggggaaaatagaagcaaacattaaaatgttttcatc |
570606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 239
Target Start/End: Complemental strand, 1037562 - 1037503
Alignment:
| Q |
180 |
agctcaaatcaagcacctccaaattggggaaaatagaagtaaacaataggatgttttcat |
239 |
Q |
| |
|
||||||||||||| | | ||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
1037562 |
agctcaaatcaagaaattgcaaattggggaaaatggaagcaaacaatatgatgttttcat |
1037503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University