View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11416_low_7 (Length: 271)

Name: NF11416_low_7
Description: NF11416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11416_low_7
NF11416_low_7
[»] chr6 (4 HSPs)
chr6 (143-215)||(1695909-1695981)
chr6 (21-83)||(1696050-1696112)
chr6 (145-188)||(1685404-1685447)
chr6 (21-64)||(1685520-1685563)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 1695981 - 1695909
Alignment:
143 atgaaagaatcaaccttagtataccagctatatttagatcaacgattagtctgacataatcatagtttatcac 215  Q
    ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||    
1695981 atgaaagaatcaaccttagtatacctgctatatttagatcaacgatgagtctgacataatcatagtttatcac 1695909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 1696112 - 1696050
Alignment:
21 tctttctctgtttattactttgttttggtgtttacgtgaatatagcgtaatttgttatgctat 83  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1696112 tctttctctgtttattactttgttttggtgtttacgtgaatatagcgtaatttgttatgctat 1696050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 145 - 188
Target Start/End: Complemental strand, 1685447 - 1685404
Alignment:
145 gaaagaatcaaccttagtataccagctatatttagatcaacgat 188  Q
    |||||||||||||| |||||||||||||||||||||||||||||    
1685447 gaaagaatcaacctaagtataccagctatatttagatcaacgat 1685404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 1685563 - 1685520
Alignment:
21 tctttctctgtttattactttgttttggtgtttacgtgaatata 64  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||    
1685563 tctttctctatttattactttgttttgttgtttacgtgaatata 1685520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University