View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11418_low_11 (Length: 247)
Name: NF11418_low_11
Description: NF11418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11418_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 6368321 - 6368093
Alignment:
| Q |
15 |
agtttgttcattctctgaaggatgaaaaaccgagaacaatttgtcttgagggaaaggaagcttcttcacattctttcgccgacatattcgccaacaacat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6368321 |
agtttgttcattctctgaaggatgaaaaactgagaacaatttgtcttgagggaaaggaagcttcttcacattctttcgccgacatattcgccaacaacat |
6368222 |
T |
 |
| Q |
115 |
gtgtcttcatattctgcttcttcatctgtgattactagatagcctgaatatggtgcatctggtggtggtatctccaaactacttggagattttctgtaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6368221 |
gtgtcttcatattctgcttcttcatctgtgattactagatagcctgaatatggtgcatctggtggtggtatctccaaactacttggagattttctgtaca |
6368122 |
T |
 |
| Q |
215 |
tagacaaaggtctagtcacatacatcttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6368121 |
tagacaaaggtctagtcacatacatcttt |
6368093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University