View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11419_low_11 (Length: 339)
Name: NF11419_low_11
Description: NF11419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11419_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 16 - 329
Target Start/End: Original strand, 7290183 - 7290496
Alignment:
| Q |
16 |
cattgtggatatattggatattaaggattgtagtgtttctttaagagtatcagtaatcaatgattatattccttatattcttgatgcaagttgatgataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7290183 |
cattgtggatatattggatattaaggattgtagtgtttctttaagagtatcagtaatcaatgattatattccttgtattcttgatgcaagttgatgataa |
7290282 |
T |
 |
| Q |
116 |
tcgtcttttggtatgttgggcagaattatgcacaaacatactttaggtaaaataaacttatcttttatgtcttgcatggtagtgccttcaaggtccaagt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
7290283 |
tcgtcttttggtatgtttggcagaattatgcacaaacatactttaggtaaaataaacttgtcttttatgccttgcatggtggtgccttcaaggtccaagt |
7290382 |
T |
 |
| Q |
216 |
tatggttgatgtaaggttacattacagtgctattttgatttatagggagtgacaaaccaaaaagttcattatatatagacataacaaatcacaatagaaa |
315 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7290383 |
tatggttgatttaaggttacattacattattattttgatttatagggagtgacaaaccaaaaagttcattatatatagacataacaaatcacaatagaaa |
7290482 |
T |
 |
| Q |
316 |
aatacggccctttg |
329 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
7290483 |
aatatggccctttg |
7290496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University