View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11419_low_13 (Length: 300)
Name: NF11419_low_13
Description: NF11419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11419_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 281
Target Start/End: Original strand, 13715300 - 13715558
Alignment:
| Q |
14 |
agatgaacttcataaataagcttgtgaaaaaggctttgcatggaattgttctcattggaaaagcgttgtttgttttgttcaacccaaataatccaaatag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13715300 |
agatgaacttcataaataagcttgtgaaaaaggctttgcatggaattgttctcattggaaaagcgttgtctgttttgttcaacccaaataat-------- |
13715391 |
T |
 |
| Q |
114 |
tatgaagcttggcagaaagcatgatttgtttcactggagggctccaaacattctacgagcaatgcagcggaatatcccaagatgataggtcgagaggttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715392 |
-atgaagcttggcagaaagcatgatttgtttcactggagggctccaaacattctacgagcaatgtagcggaatatcccaagatgataggtcgagaggttg |
13715490 |
T |
 |
| Q |
214 |
atttatattgttgctgagccaattccaaaattgtgaggtgacagagcaattaaaaataatgtgctcag |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715491 |
atttatattgttgctgagccaattccaaaattgtgaggtgacagagcaattaaaaataatgtgctcag |
13715558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University