View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_high_22 (Length: 341)
Name: NF1141_high_22
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 6e-99; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 44 - 230
Target Start/End: Complemental strand, 47051507 - 47051321
Alignment:
| Q |
44 |
caggtcaaaacttccgtacaaattactcaaccattcaaatgtcttaaacagctaaacctcgtccttttcgcggattcgtttatatatgacatgggctatg |
143 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051507 |
caggtcaaaacttccatacaaattactcaaccattcaaatgtcttaaacagctaaacctcgtccttttcgcggattcgtttatatatgacatgggctatg |
47051408 |
T |
|
| Q |
144 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatgttaagacaaatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051407 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatgttaagacaaatg |
47051321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 47929058 - 47929131
Alignment:
| Q |
144 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacat |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
47929058 |
gtcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaactctctgtcatggtgagtgaacat |
47929131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 48107571 - 48107506
Alignment:
| Q |
152 |
tggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacat |
217 |
Q |
| |
|
|||||||||||||| ||||||| || |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
48107571 |
tggattttaaacatccttcaagtttgtccttttttgcagaaactttcagccatggtgagtgaacat |
48107506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 145 - 218
Target Start/End: Complemental strand, 48453503 - 48453430
Alignment:
| Q |
145 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatg |
218 |
Q |
| |
|
|||||| |||||||||||||| || |||| ||||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
48453503 |
tcttttctggattttaaacatcctacaagtttctcctcttttgcagaaacttttggttatggtgagcgaacatg |
48453430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 311
Target Start/End: Complemental strand, 47051275 - 47051240
Alignment:
| Q |
276 |
atcttggttcagtaaataaatttacacttttgacag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051275 |
atcttggttcagtaaataaatttacacttttgacag |
47051240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 152 - 207
Target Start/End: Original strand, 48895116 - 48895171
Alignment:
| Q |
152 |
tggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggt |
207 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
48895116 |
tggattttaaacattcttcaagcttgccctcttttgcataaactttcagtcatggt |
48895171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 48571222 - 48571156
Alignment:
| Q |
148 |
tttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaa |
214 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||| ||||||||||| | || |||||||||||||| |
|
|
| T |
48571222 |
tttgtggatcttaaacatccttaaagcttctcctattttgcagaaattgtccctcatggtgagtgaa |
48571156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 93
Target Start/End: Complemental strand, 48571304 - 48571255
Alignment:
| Q |
44 |
caggtcaaaacttccgtacaaattactcaaccattcaaatgtcttaaaca |
93 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
48571304 |
caggtcacaacttctctacaaattactcaaccattcaaacatcttaaaca |
48571255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 145 - 218
Target Start/End: Original strand, 50459595 - 50459668
Alignment:
| Q |
145 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatg |
218 |
Q |
| |
|
||||||||||||| | ||||| |||||| ||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50459595 |
tcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaactttcaatcatggtgagtgaacatg |
50459668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University