View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_high_32 (Length: 268)
Name: NF1141_high_32
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 58 - 189
Target Start/End: Original strand, 9150095 - 9150226
Alignment:
| Q |
58 |
gcgttgaatatgcacttagtagaacaatttgtcatttatgtgaaatttttggccataatgaaaatctaaacatacacccagcgtgaagagccattgtgag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9150095 |
gcgttgaatatgcacttagtagaacaatttgtcatttatgtgaaatttttggccataatgaaaatctaaacatacacccagtgtgaagagccattgtgag |
9150194 |
T |
|
| Q |
158 |
acaacaaataagtgaccaaactaaaatttcct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9150195 |
acaacaaataagtgaccaaactaaaatttcct |
9150226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 257
Target Start/End: Original strand, 9150240 - 9150292
Alignment:
| Q |
205 |
gcgataaatcttaannnnnnnatttcatgttgctctatttttagtatagtata |
257 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9150240 |
gcgataaatcttaatttttttatttcatgttgctctatttttagtatagtata |
9150292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University