View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_high_35 (Length: 267)
Name: NF1141_high_35
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_high_35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 267
Target Start/End: Original strand, 45078819 - 45079072
Alignment:
| Q |
9 |
accacagatagaagatacaaaagcaattgagttcttaccttcgtggaggtttgctaatgggatgttcgctttggtcctttcatttggccttctccttact |
108 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45078819 |
accaaagagagaagatacaaaagcaattgagttcttaccttcgtggaggtttgctaatgggatgttcgctttggtcctttcatttggccttctccttact |
45078918 |
T |
 |
| Q |
109 |
gcattaaaaagcagaaaggctagatcatggcgttatggtagtggtaagtgctatataatatacatatgcagattgtctctgcaacttaaaagttctgaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
45078919 |
gcattaaaaagcagaaaggctagatcatggcgttatggtagtggtaagtgct-----atatacatatgtaaattgtctctgcaacttaaaagttctgaac |
45079013 |
T |
 |
| Q |
209 |
ccgtcactgcatataatcatttggttttcttagaaaataatttatttaactttaactac |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45079014 |
ccgtcactgcatataatcatttggttttcttagaaaataatttatttaactttaactac |
45079072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University