View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_high_40 (Length: 216)
Name: NF1141_high_40
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 78 - 131
Target Start/End: Original strand, 1205019 - 1205072
Alignment:
| Q |
78 |
gcaaaggtggtagattggtgttttgtgatcaatgaaagaaactgtgtggctcaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1205019 |
gcaaaggtggtagattggtgttttgtgatcaatgaaagaaactgcgtggctcaa |
1205072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 1205192 - 1205227
Alignment:
| Q |
181 |
taacaaatttatatatgtacacttttctcattctcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1205192 |
taacaaatttatatatgtacacttttctcattctcc |
1205227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 1205086 - 1205118
Alignment:
| Q |
142 |
ttgttacaatttccgtgtaatattattacataa |
174 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
1205086 |
ttgttacaatttgcgtgtaatattattacataa |
1205118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University