View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_15 (Length: 534)
Name: NF1141_low_15
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 488; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 488; E-Value: 0
Query Start/End: Original strand, 30 - 525
Target Start/End: Complemental strand, 52825343 - 52824848
Alignment:
| Q |
30 |
gtaacttgtgcactacggaacataactaaaccattgttgaatacccaggtgaatactggtgacaaagatgacatgatgcagagcttcttccttgcagaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52825343 |
gtaacttgtgcactacggaacataactaaaccattgttgaatacccaggtgaatacaggtgacaaagatgacatgatgcagagcttcttccttgcagaaa |
52825244 |
T |
 |
| Q |
130 |
ccctcaagtacctctatctcttgttttcaccaccttccgttatctctctcgatgaatgggtgttcaacacagaagcacaccctttaagaattgttactag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52825243 |
ccctcaagtacctctatctcttgttttcaccaccttccgttatctctctcgatgaatgggtgttcaacacagaagcacaccctttaagaattgttactag |
52825144 |
T |
 |
| Q |
230 |
aaattctcatgaagaaggacagagtatagacccagaggaaaaaattcctcatcatttgcatggtagaaaagaaggtcgaattgattacaagtagttaagg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52825143 |
aaattctcatgaagaaggacagagtatagacccagaggaaaaaattcctcatcatttgcatggtagaaaagaaggtcgaattgattacaagtagttaagg |
52825044 |
T |
 |
| Q |
330 |
gttgttgctctatgattgtagcaacaaaccctgaaggtatgcatgacttcccttttctcaaatatccaggacatatttgtgctatgtgacagccgttgtc |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52825043 |
gttgttgctctatgattgtagcaacaaaccctgaaggtatgcatgacttcccttttctcaaatatccaggacatatttgtgctacgtgacagccgttgtc |
52824944 |
T |
 |
| Q |
430 |
acggtcttgcatgtgggggtgatccaccattttggttgattcttgcagagaggcaactcgtcctgctccatcaacatgcagttggtttgtctgtgg |
525 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824943 |
acggtcttgcatgtgggggtgatccaccattttggttgattcttgcagagaggcaactcgtcctgctccatcaacatgcagttggtttgtctgtgg |
52824848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 1405286 - 1405329
Alignment:
| Q |
180 |
gatgaatgggtgttcaacacagaagcacaccctttaagaattgt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
1405286 |
gatgaatgggtattcaacacagaagcacaccctttgaggattgt |
1405329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University