View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_25 (Length: 389)
Name: NF1141_low_25
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 99 - 379
Target Start/End: Original strand, 40691341 - 40691621
Alignment:
| Q |
99 |
atatcaccatttccggatacaaactgacatctttgatcactacgaatgtgagcgaaatgttcaaccatatgcatcatccacaattatcagctctatagtt |
198 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40691341 |
atatcacgacttccggatacaaactgacatctttgattactacgaatgcgagcgaaatgttcaaccatatacatcatccacaattatcagctctatagtt |
40691440 |
T |
 |
| Q |
199 |
gtctcttgtaaataaaatgtaccagttttatttttaaaatatagaatctatgtcacattagttgtttttagaataattaaaagagaaatttcaatataaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40691441 |
gtctcttgtaaataaaatgtaccagttttatttttaaaatatagaatctatgtcacattagttgtttttagaataattaaaagagaaatttcaatataaa |
40691540 |
T |
 |
| Q |
299 |
ttagaactaccttaactctcaaaacaaaaatatcactattcagccagttttgttactttcttggcttgttgcatctctgtg |
379 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40691541 |
ttagaactacctttactctcaaaacaaaaatatcactattcagccagttttgttactttcttggcttgttgcatctctgtg |
40691621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University