View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_36 (Length: 332)
Name: NF1141_low_36
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_36 |
 |  |
|
| [»] scaffold0179 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 894354 - 894284
Alignment:
| Q |
30 |
tttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894354 |
tttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc |
894284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 232
Target Start/End: Original strand, 6462 - 6570
Alignment:
| Q |
124 |
tccattcctctcctttctcctctaggataannnnnnnncttctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaaca |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6462 |
tccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaaca |
6561 |
T |
 |
| Q |
224 |
ccctgaaaa |
232 |
Q |
| |
|
|||| |||| |
|
|
| T |
6562 |
ccctcaaaa |
6570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 6371 - 6436
Alignment:
| Q |
30 |
tttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctct |
95 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6371 |
tttcatggttgttggattccactaccattgcaatattgtggtaaaattatatcttatttcttctct |
6436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 290 - 327
Target Start/End: Original strand, 6629 - 6666
Alignment:
| Q |
290 |
gggtgtttgattattggtgaatttgtgtctgtggtgct |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6629 |
gggtgtttgattattggtgaatttgtgtctgtgttgct |
6666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University