View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_37 (Length: 331)
Name: NF1141_low_37
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 81 - 305
Target Start/End: Complemental strand, 7199233 - 7199003
Alignment:
| Q |
81 |
gttgtgacctccatcattcatatttttcttcttgttctcattctttcgatgtttaccagatttgtgtccaactgttgaattttctggatgaacttttttc |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7199233 |
gttgggacctccatcattcatatttttcttcttgttctcattctttcgatgtttaccagatttgtgtccaactgttgaattttctggatgaacttttttc |
7199134 |
T |
 |
| Q |
181 |
cggaacatatggagaatctagaaaccaaaacca------aaactcataatcatgaacagaacaataccatttatctaccaagaccaaaaacagtgatgtg |
274 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7199133 |
ctgaacatatggagaatctagaaaccaaaaccaaaaccaaaacttataatcatgaacagaacaataccatttatctaccaagaccaaaaacagtgatgtg |
7199034 |
T |
 |
| Q |
275 |
aattggttagaacagtttacagaggcctatg |
305 |
Q |
| |
|
||| ||| ||||||||||||||||||||||| |
|
|
| T |
7199033 |
aataggtcagaacagtttacagaggcctatg |
7199003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University