View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_39 (Length: 318)
Name: NF1141_low_39
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 96 - 317
Target Start/End: Original strand, 17395925 - 17396146
Alignment:
| Q |
96 |
acattttgttgagggggagtcggttgaggttgaaacttaaaccgataaggtgtaaaatcaaacggttctgattcctggtctggttgagggggagccgatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17395925 |
acattttgttgagggggagtcggttgaggttgaaacttaaaccgataaggtgtaaaatcaaacggttctgattcctggtctggttgagggggagccgatt |
17396024 |
T |
 |
| Q |
196 |
gggtcggttgaggttgaaacttatacgtataaggagtgatatcacacgattctgcttcttcnnnnnnntcaaacgattctggttgctggtccggttgggg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
17396025 |
gggtcggttgaggttgaaacttatacgtataaggggtaaaatcacacgattctgcttcttcaaaaaaatcaaacgattctggttgttggtctggttgggg |
17396124 |
T |
 |
| Q |
296 |
ctttatcttgtcatcttttatc |
317 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
17396125 |
ctttatattgtcatcttttatc |
17396146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University