View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_51 (Length: 268)
Name: NF1141_low_51
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 28 - 220
Target Start/End: Complemental strand, 18943981 - 18943789
Alignment:
| Q |
28 |
cagagactaatcactcgtcagataagacctctgtgaatgccaaaacatatttaaaactgctgcgtttctaacgttagatttgaacccatacttgtaatta |
127 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18943981 |
cagagactaatcgctcgtcagataagacctctgtgaatgccaaaacatatttaaaactgctgcatttctaacgttagatttgaacccatacctgtaatta |
18943882 |
T |
 |
| Q |
128 |
agcttaaaagatcatttgtcatctcattcagatgcttttggtaaacctgctctttgaaatgatggatcggagaagtacattttccttgtattt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18943881 |
agcttaaaagatcatttgtcatctcattcaaatgcttttggtaaacctgctcttggaaatgacggatcggagaagtacattttccttgtattt |
18943789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University