View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1141_low_55 (Length: 235)
Name: NF1141_low_55
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1141_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 145 - 226
Target Start/End: Original strand, 32558340 - 32558421
Alignment:
| Q |
145 |
gggaatttgcatgtgaatccatggtttaaataagagagactctggttttttgaattctcctttttacccttgtgatattgtt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32558340 |
gggaatttgcatgtgaatccatggtttaaataagagagactctggttttttgaattctcctttttacccttgtgattttgtt |
32558421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 32558196 - 32558267
Alignment:
| Q |
1 |
ttcaaaggactcattgtaatgtgagaagttattgtgtgattgagaaacaagaaaatggcatgtaatgcaaga |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32558196 |
ttcaaaggactcattgtaatgtgagaagttattgtgtgattgagaaacaagaaaatggcatgtaatgcaaga |
32558267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University