View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1141_low_62 (Length: 213)

Name: NF1141_low_62
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1141_low_62
NF1141_low_62
[»] chr4 (1 HSPs)
chr4 (1-134)||(26755460-26755593)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 26755593 - 26755460
Alignment:
1 gtagcagcaacttgatcttcctccagtaatagctggtccggaaaaataatggtgatctcttcgggcacatcagttgagggaatttggttcctttggtgaa 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
26755593 gtagcagcaaattgatcttcctccagtaatagctggtccggaaaaataatggtgatctcttcaggcacatcagttgagggaatttggttcctttggtgaa 26755494  T
101 tttctgtgtccttattctctaggtctgtggtgct 134  Q
    |||||||||||||||||||||||| |||| ||||    
26755493 tttctgtgtccttattctctaggtttgtgttgct 26755460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University