View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1141_low_64 (Length: 203)

Name: NF1141_low_64
Description: NF1141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1141_low_64
NF1141_low_64
[»] chr7 (1 HSPs)
chr7 (1-36)||(32558185-32558220)


Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 32558220 - 32558185
Alignment:
1 ctcacattacaatgagtcctttgaaaggaaagaaga 36  Q
    ||||||||||||||||||||||||||||||||||||    
32558220 ctcacattacaatgagtcctttgaaaggaaagaaga 32558185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University