View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_high_13 (Length: 317)
Name: NF11420_high_13
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 24690691 - 24690385
Alignment:
| Q |
1 |
aactgatggtccttgctctgaagtgtgaatcagtggtatggaccagttcttaagatcaactcttcgcaatgtgagtgcagtaatcatcagaccatcactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690691 |
aactgatggtccttgctctgaagtgtgaatcagtggtatggaccagttcttaagatcaactcttcgcaatgtgagtgcagtaatcatcagaccatcactg |
24690592 |
T |
 |
| Q |
101 |
cgcaggcctagatgaccagtatgaatattatgaggttcagtatgcagatcatggatcttcagttcactaacaaagttacactgaaatattatttgttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690591 |
cgcaggcctagatgaccagtatgaatattatgaggttcagtatgcagatcatggatcttcagttcactaacaaagttacactgaaatattatttgttttg |
24690492 |
T |
 |
| Q |
201 |
atgactctcgaagtccacatgatgctattgttgtttcatttcagttttttaagtcttggtaaatacaacaataatgatgaggctgcaatgtgcattcagc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24690491 |
atgactctcgaagtccacatgatgctattgttgtttcatttcagttttttaagtcttggtaaat---acaataatgatgaggctgcaatgtgcattcagc |
24690395 |
T |
 |
| Q |
301 |
tggttctgtg |
310 |
Q |
| |
|
||||| |||| |
|
|
| T |
24690394 |
tggttttgtg |
24690385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 303
Target Start/End: Complemental strand, 24717826 - 24717745
Alignment:
| Q |
223 |
tgctattgttgtttcatttcagttttttaagtcttggtaaatacaaca-ataatgatgaggctgcaatgtgcattcagctgg |
303 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| | |||||| || || ||||||| ||||| |||||| |||||||| |
|
|
| T |
24717826 |
tgctattgttgttttgtttcagttttttaagtcttgttgaatacatcagctattgatgagactgcagtgtgcactcagctgg |
24717745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 249
Target Start/End: Complemental strand, 24630879 - 24630845
Alignment:
| Q |
215 |
ccacatgatgctattgttgtttcatttcagttttt |
249 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
24630879 |
ccacataatgctattgttgtttcatttcagttttt |
24630845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University