View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_high_16 (Length: 305)
Name: NF11420_high_16
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 282
Target Start/End: Complemental strand, 30923763 - 30923501
Alignment:
| Q |
20 |
gaacaaaaatggttaacgaacctccttttgcttgcaatactcaacatcagtccaacaatcctctcttttgacaacatcagaaggccaattaggactaggt |
119 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
30923763 |
gaacaaaaatggtgaacaaacctctttttgcttgcaatactcaacatcagtccaacaatcctctctctttacaacatcagaaggccaattaggactaggt |
30923664 |
T |
|
| Q |
120 |
ataatagcagagatagaagaagtaacaaccactcgcttcacccctacttccttcgccgcagtaagcacattcaaagtccctttaattgcaggatccaaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923663 |
ataatagcagagatagaagaagtaacaaccactcgcttcacccctacttccttcgccgcagtaagcacattcaaagtccctttaattgcaggatccaaaa |
30923564 |
T |
|
| Q |
220 |
gctccttctacaaaaccaaacccaatagcttcaaaacctctgtagcaataacacgtgtaatga |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
30923563 |
gctccttctacaaaaccaaacccaatagcttcaaaacctctgtagcactaacacatgtaatga |
30923501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University