View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11420_high_18 (Length: 298)

Name: NF11420_high_18
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11420_high_18
NF11420_high_18
[»] chr1 (1 HSPs)
chr1 (219-282)||(6946160-6946223)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 219 - 282
Target Start/End: Complemental strand, 6946223 - 6946160
Alignment:
219 atttcgcagccaacatgacaaggatattgagatacaaccaagacgactcaacaatgcaattaac 282  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
6946223 atttcgcagccaacatgataaggatattgagatacaaccaagacgactcaacaatgcaattaac 6946160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University