View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_high_32 (Length: 239)
Name: NF11420_high_32
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 135 - 221
Target Start/End: Complemental strand, 28897489 - 28897403
Alignment:
| Q |
135 |
agtagggccgactgttgctgttgaagaaattgtaacaccttgatttccaccccaagcatttataattatgtgagcaaggtaattttg |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28897489 |
agtagggccgattgttgctgttgaagaaattgtaacaccttgatttccaccccaagcatttataattatgtgagcaaggtaattttg |
28897403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University