View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_low_10 (Length: 392)
Name: NF11420_low_10
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_low_10 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 313 - 392
Target Start/End: Original strand, 12559502 - 12559581
Alignment:
| Q |
313 |
agggtgattgctcatcttgttgatagttacttgaaagggaaaagaagcagtaaaaacatagggagatatgtgaaaattcc |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12559502 |
agggtgattgctcatcttgttgatagttacttgaaagggaaaagaagcagtaaaaacatagggtgatatgtgaaaattcc |
12559581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 12559407 - 12559499
Alignment:
| Q |
11 |
cagagaatgtatcattttgttttttattcttgagtcaaaactcaaaaggcaattccactcagaatcaacc----ttgcatcatgatatataac |
99 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12559407 |
cagagaatgtatcatcttgttttttatttttgagtcaaaactcaaaaggcaattccactcagaatcaaccttaattgcatcatgatatataac |
12559499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 360
Target Start/End: Complemental strand, 44836716 - 44836650
Alignment:
| Q |
294 |
cagactcctatatcattggagggtgattgctcatcttgttgatagttacttgaaagggaaaagaagc |
360 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| || |||||| |||||||||| | |||||| |
|
|
| T |
44836716 |
cagactcctatataattggagggttattgctcatcttttttatagttgcttgaaaggggagagaagc |
44836650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University