View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_low_29 (Length: 245)
Name: NF11420_low_29
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 40963083 - 40963297
Alignment:
| Q |
19 |
aactgaacttgttttttgtgtcggtttcacgtcactacactgcnnnnnnngtggcttgttttggattggaatttctgagtacaactataatacacatgtg |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40963083 |
aactgaacttgttttt-gtgtcggtttcacgtcactacactgctttttttgtggcttgttttggattggaatttctgagtacaactacaatacacatgtg |
40963181 |
T |
|
| Q |
119 |
caagtacttgactctttactcaaatgggttggtttcataagtcattttcatgcagtctttatgctcaagtttggaaatttatgacattccattgaagtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40963182 |
caagtacttgactctttactcaaatgggttggtttcataagtcattttcatgcagtctttatgctcaagtttggaaatttatgacattccattgaagtta |
40963281 |
T |
|
| Q |
219 |
cttgttggtgttctct |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40963282 |
cttgttggtgttctct |
40963297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University