View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_low_34 (Length: 235)
Name: NF11420_low_34
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 7240283 - 7240064
Alignment:
| Q |
2 |
gaggttgaattggctaaaaaattagtccagattctaaagaaacatcaatatccagcaacaaaggttccaaggataaggaggtttgtgattgagctggcta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7240283 |
gaggttgaattggctaaaaaattagtccagattctaaagaaacatcaatatccagcaacaaaggttccaaggataaggaggtttgtgattgagctggcta |
7240184 |
T |
 |
| Q |
102 |
tttggatgatgatagacaaagaagaaaacataagtaattttaaggatcttcaaatggaagaggtgttggagggtgtattagagaccacatcagagcttga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7240183 |
tttggatgatgatagacaaagaagaaaacataagtaattttaaggatcttcaaatggaagaggtgttggagggtgtattagagaccacatcagagcttga |
7240084 |
T |
 |
| Q |
202 |
aagctttaacgttttctctg |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7240083 |
aagctttaacgttttctctg |
7240064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 221
Target Start/End: Original strand, 48733477 - 48733606
Alignment:
| Q |
92 |
gagctggctatttggatgatgatagacaaagaagaaaacataagtaattttaaggatcttcaaatggaagaggtgttggagggtgtattagagaccacat |
191 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| |||||||||| | || || ||||| ||||| || | ||| | ||||| |||||||| |||| |
|
|
| T |
48733477 |
gagctggcaatttggatgatgaaagacaaaggagaaaacatatacacattcaaagatctaggcatggaggaattattgaaaggtgttttagagacaacat |
48733576 |
T |
 |
| Q |
192 |
cagagcttgaaagctttaacgttttctctg |
221 |
Q |
| |
|
|||||||||| | |||||| |||||||||| |
|
|
| T |
48733577 |
cagagcttgagaactttaatgttttctctg |
48733606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University