View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11420_low_36 (Length: 201)
Name: NF11420_low_36
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11420_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 12559558 - 12559725
Alignment:
| Q |
15 |
catagggagatatgtgaaaattccaaggcaatgaatacaataatatttactaataacattgatcaacagtcatggaacaagtgatgccagacaaccaaaa |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| | ||||| ||||||||||||||||||| |
|
|
| T |
12559558 |
catagggtgatatgtgaaaattccaaggcaatgaatacaataatatttacaaataacattgatcaatagtcaagaaacaaatgatgccagacaaccaaaa |
12559657 |
T |
 |
| Q |
115 |
cacaagacacagaccaatattactgggtcaaacatgtgcttttatctcaaaattacaacattgatatg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559658 |
cacaagacacagaccaatattactgggtcaaacatgtgcttttatctcaaaattacaacattgatatg |
12559725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University