View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_high_13 (Length: 313)
Name: NF11421_high_13
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 174 - 303
Target Start/End: Complemental strand, 298766 - 298637
Alignment:
| Q |
174 |
aatgcctaatttgtcccgtgtaacacacctaaatctgatactatgtgggatatatattgccttggctttgcacttcatttaaagtatgcttaattctact |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298766 |
aatgcctaatttgtcccgtgtaacacacctaaatctgatactatgtgggatatatattggcttggctttgcacttcatttaaagtatgcttaattctact |
298667 |
T |
 |
| Q |
274 |
tttggcacatggtgtgattttgtccctttg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
298666 |
tttggcacatggtgtgattttgtccctttg |
298637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 298884 - 298850
Alignment:
| Q |
20 |
agcagttgtaacaaaacatctctgggtcaagatcc |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
298884 |
agcagttgtaacaaaacatctctgggtcaagatcc |
298850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University