View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_high_15 (Length: 270)
Name: NF11421_high_15
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 5 - 268
Target Start/End: Original strand, 44694139 - 44694402
Alignment:
| Q |
5 |
ttcaaacgaataacaagggtttgtttgtgtcctgatttttcttgaatgtaatatataaaaactaattagtaaattaatattattatcacatcagctatgt |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694139 |
ttcaaacaaataacaagggtttgtttgtgtcctgatttttcttgaatgtaatatataaaaactaattagtaaattaatattattatcacatcagctatgt |
44694238 |
T |
 |
| Q |
105 |
cttggcttcatatgcaaaattcctatgggatgctgaagaagatgaagataatgactgccaacataaaactgataagagccatacacattcacctgatctt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694239 |
cttggcttcatatgcaaaattcctatgggatgctgaagaagatgaagataatgactgccaacataaaactgataagagccatacacattcacctgatctt |
44694338 |
T |
 |
| Q |
205 |
tttctaggagctaatggtcgttctcatgtcactgcagcctctaaaatctaacctctctgcttct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694339 |
tttctaggagctaatggtcgttctcatgtcactgcagcctctaaaatctaacctctctgcttct |
44694402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 2305751 - 2305691
Alignment:
| Q |
100 |
tatgtcttggcttcatatgcaaaattcctatgggatgctgaagaagatgaagataatgact |
160 |
Q |
| |
|
|||||| | ||||||||||| |||||||| |||||||||||| | || |||||||| |||| |
|
|
| T |
2305751 |
tatgtcctagcttcatatgccaaattcctttgggatgctgaaaatgaagaagataaagact |
2305691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University