View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_high_19 (Length: 214)
Name: NF11421_high_19
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 36172668 - 36172849
Alignment:
| Q |
18 |
gtttttactcggttttatttgtccacttaagttcaattcattcatacattttctctgtacaatccttcagctaattatgtgtggtcctgtcaaaaagaaa |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36172668 |
gtttttactcggttttattggtccacttaagttcaattcattcatacattttctctgtacaatccttcagctaattatgtgtggtcctgtcaaaaagaaa |
36172767 |
T |
 |
| Q |
118 |
actaatttatgtgtggctaacgttccctctccctgcatgcttttgtgaatgaatgagacttcttcggtcataaagcattcat |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36172768 |
actaatttatgtgtggctaaggttccctctccctgcatgcttttgtgaatgaatgagacttcttcggtcataaagcattcat |
36172849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University