View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_high_6 (Length: 503)
Name: NF11421_high_6
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 2e-84; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 260 - 422
Target Start/End: Complemental strand, 37884778 - 37884616
Alignment:
| Q |
260 |
tccagacgaatgaaaaaagtaaagtatattttaatttatctattctttgatcgggagtttaagtgcacatttggttgcaccatggagcgcaccaaacatg |
359 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37884778 |
tccagacgaatgacaaaagtaaagtatattttaatttatctattctttgatcgggagtttaagtgcacatttggttgcaccatggagcgcaccaaacatg |
37884679 |
T |
 |
| Q |
360 |
agtctattctttggtttattatttcttgacttgagtttggtaataagaagcaattaaacatta |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37884678 |
agtctattctttggtttattatttcttgacttgagtttggtaataagaagcaattaaacatta |
37884616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 7 - 84
Target Start/End: Complemental strand, 37885033 - 37884956
Alignment:
| Q |
7 |
gcagcacagacttatgcaggagatgatccgtgtccaaactctttgtaatctctttggcgtaacttgtgttgaaatgac |
84 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37885033 |
gcagcacaaacttatgcaggagatgatccgtgtccaaactctttgtaatctctttggcgtaacttgtgttgaaatgac |
37884956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 37884885 - 37884852
Alignment:
| Q |
155 |
atcatatgtattctaataaaactagagtttcttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
37884885 |
atcatatgtattctaataaaactagaatttcttt |
37884852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University