View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_low_14 (Length: 312)
Name: NF11421_low_14
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 47469566 - 47469279
Alignment:
| Q |
19 |
catgttgtgagggtagtcttcaacgtcttggggtggattacattgatctctattatcagcaccgtattgacaccactgttcccattgaggacactgtaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469566 |
catgttgtgagggtagtcttcaacgtcttggggtggattacattgatctctattatcagcaccgtattgacaccactgttcccattgaggacactgtaag |
47469467 |
T |
 |
| Q |
119 |
taatagaatctattcttaaaatttgttaggaagtggtaggtaggtactagtgtttttgatttggtgttttgaatgaatcacagatgggagagcttaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469466 |
taatagaatctattcttaaaatttgttaggaagtggtaggtaggtactcgtgtttttgatttggtgttttgaatgaatcacagatgggagagcttaagaa |
47469367 |
T |
 |
| Q |
219 |
gttggttgaagagggaaagattaagtacataggattatctgaggctagtactgatacaatcagaagggcacatgatgtccatctcatt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |
|
|
| T |
47469366 |
gttggttgaagagggaaagattaagtacataggattatctgaggctagtactgatacaatcagaagggcacatgctgttcatcccatt |
47469279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University