View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_low_17 (Length: 265)
Name: NF11421_low_17
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 17504945 - 17505189
Alignment:
| Q |
11 |
ttgctctttacacattgatttttgtttattgaaacctcaaaatatacaaataccctcaccgacagttaactgccactatgttgcaaaaattaaatgnnnn |
110 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||| |||||||||| || ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
17504945 |
ttgctctttacacattggtttttgcttattgaaacctcaaaatacacaaatacccccaacgacagttaactgtcgctatgttgcaaaaattaaatgaaaa |
17505044 |
T |
|
| Q |
111 |
nnnnnnnnnccaacggcacttgagaaccgttgtagcctatctcacaaaaccgacatgataaatgtgcacttaagtgcttatcgatggcctatatcacagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17505045 |
taaaaaaa-ccaacggcacttgagaaccgttgtagcctatctcacaaaaccaacatgataaatgtgcacttaagtgcttatcaatggcctatatcacagt |
17505143 |
T |
|
| Q |
211 |
tatatccctttcaaatgtccaataccattccttttttgccctttgc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17505144 |
tatatccctttcaaatgtccaataccattccttttttgccttttgc |
17505189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University