View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_low_18 (Length: 253)
Name: NF11421_low_18
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 30383188 - 30382944
Alignment:
| Q |
19 |
gttgtaaggtttttgagtttcttaatttgtttgctttgaggtaggtaattgag------------caaatttagtagaagtgatttgatcgtaaacaatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
30383188 |
gttgtaaggtttttgagtttcttaatttgtttgctttgaggtaggtaattgagttgtaaattgagcaaatttagtagaagtgatttgattgtaaacaatt |
30383089 |
T |
|
| Q |
107 |
attccgtaaccatatatacatgatttatttatacatgtttaaatttaaaggagttcgagttctatggactaagaaaaagcatcacggtatgtgtgtgtat |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||| | ||||| | |
|
|
| T |
30383088 |
attctgtaaccatatatacatgatttatttatacatgtttaaatttaaaggagttcgaattttatagactaagaaaaagcatcacggta--tatgtgtct |
30382991 |
T |
|
| Q |
207 |
aagtgactcatatttatgcttctgattacatacatttgcaacccatt |
253 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30382990 |
aagtgactcatatttatgcctctgattacatacatttgcaacccatt |
30382944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University