View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_low_19 (Length: 240)
Name: NF11421_low_19
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 23323831 - 23323629
Alignment:
| Q |
18 |
cctacttggagcaatccacctcctttgaatgatattcaagttccacctttgaacatcaaagtgtatgataatgatgctgctataataatcgatccggttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23323831 |
cctacttggagcaatccacctcctttgaatgatattcaagttccacccttgaacatcaaagtgtatgataatgatgctgctataataatcgacccggttt |
23323732 |
T |
 |
| Q |
118 |
cttttccagctatgccgaagttttcttcaaatgttacctcaacttgttcagcttcttcaatgcttaactttgctggtaatcttgttcctcatggttcatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23323731 |
cttttccagctatgccgaagttttcttcaaatgttacctcaacttgttcagcttcttcaatgcttaactttgctggtaatcatgtgcctcatggttcatg |
23323632 |
T |
 |
| Q |
218 |
gaa |
220 |
Q |
| |
|
||| |
|
|
| T |
23323631 |
gaa |
23323629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University