View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11421_low_22 (Length: 213)
Name: NF11421_low_22
Description: NF11421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11421_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 36173216 - 36173032
Alignment:
| Q |
17 |
acatcagacacccactaaacgtagttatcttttttggcgtaacattcagtttgataacaataaagtgtacttcagtaattgcagtaataaaacaatagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36173216 |
acatcagacacccactaaacgtagttatcttttttggcgcaacattcagtttgataacaataaagtgtacttcagtaattccagtaataaaacaatagaa |
36173117 |
T |
|
| Q |
117 |
tgtgcttctgt----nnnnnnnnnnnnnnnncggagtgcactatttttcactcaggctctagaactagggaggctgaatggaata |
197 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36173116 |
tgtgcttctgtaaaaaaaaaaaaaaaaaaaatggagtgcactatttttcactcaggctctagaacttgggaggctgaatggaata |
36173032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University