View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11422_high_14 (Length: 347)
Name: NF11422_high_14
Description: NF11422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11422_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 4389784 - 4389466
Alignment:
| Q |
18 |
catcctcatcatcatgaagcgaaaacacaccaaagcttttaccaatgtcctcatgtgcatctattttgttttgtaaatccctatgaaccttacttttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389784 |
catcctcatcatcatgaagcgaaaacacaccaaagcttttaccaatgtcctcatgtgcatctattttgttttgtaaatccctatgaaccttacttttatt |
4389685 |
T |
 |
| Q |
118 |
tttagccggcgccttttttctatttcccgtttgcaaatttattgccaatactactctaaaatgttttacagtggactgcatcaagtagacaagtctaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389684 |
tttagccggcgccttttttctatttcccgtttgcaaatttattgccaatactactctaaaatgttttacagtggactgcatcaagtagacaagtctaacc |
4389585 |
T |
 |
| Q |
218 |
caagaatatattttccttttattgggaattcagatatgttgggccaataaagctaaaaccaggaggcttaacgtgtctttcccttgttttaataactccc |
317 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389584 |
caagaatatattttccctttattgggaattcagatatgttgggccaataaagctaaaaccagaaggcttaacgtgtctttcccttgttttaataactccc |
4389485 |
T |
 |
| Q |
318 |
aattcatgccctagttcat |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4389484 |
aattcatgccctagttcat |
4389466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University