View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11422_high_21 (Length: 255)
Name: NF11422_high_21
Description: NF11422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11422_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 16882379 - 16882618
Alignment:
| Q |
1 |
gtgacgccccttgaaatttagaagaggtaacgaacctaatctctatcatatttcttttcttgatgatctagttgtcattgttgaagcttctatggaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||| || ||||||||||||| ||| || |
|
|
| T |
16882379 |
gtgacgccccttgaaatttagaagaggtaacgaacctaatctctctcatgtttcttttgttgatgatctagttgtcgttattgaagcttctatagactaa |
16882478 |
T |
 |
| Q |
101 |
gataatatgat-caagaagttgttagataacttttgcctccactcgggacaaaacgttagtgagcataaatcaaaagtcttgagtatgctaggtcctctt |
199 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16882479 |
gatgatatgatgcaagaagttgttagataacttttgcctccactcgggaccaaacgttagtgagcataaatcaaaagtcttgggtatgctaggtcctctt |
16882578 |
T |
 |
| Q |
200 |
gtcccttctaatgaaataaactatattgttgcattttatg |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16882579 |
gtccctcctaatgaaataaactatattgttgcattttatg |
16882618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University