View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11422_high_24 (Length: 241)
Name: NF11422_high_24
Description: NF11422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11422_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 23447314 - 23447540
Alignment:
| Q |
1 |
ttatgtcatggattaatagttcagtgaacgctgaaattgcctgaagcatgttctagatggatactgttactgaaattccccaatgatttggtcactgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23447314 |
ttatgtcatggattaatagttcagtgaacgctaaaattgactgaagcatgttctagatggatgctgttactgaaattccccaatgatttggtcactgaac |
23447413 |
T |
|
| Q |
101 |
tacagagtattccaaaacactgcagccctnnnnnnnnnt----cactggcctacgctnnnnnnntaaagtttattagcaaacttctaacaa-ggatatgg |
195 |
Q |
| |
|
|||||||||||| ||||||||||||| || |||||||||| ||| || || ||||||||||||||||||||| |||||||| |
|
|
| T |
23447414 |
tacagagtattctaaaacactgcagcactaaaaaaaaaaaatacactggcctaggctaaaaaaatagagcttattagcaaacttctaacaaaggatatgg |
23447513 |
T |
|
| Q |
196 |
cagacatcttaactatttaccacaacg |
222 |
Q |
| |
|
|| |||| ||||||||||||||||||| |
|
|
| T |
23447514 |
catacattttaactatttaccacaacg |
23447540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 114
Target Start/End: Complemental strand, 23878275 - 23878242
Alignment:
| Q |
81 |
caatgatttggtcactgaactacagagtattcca |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
23878275 |
caatgatttggtcactgaactgcagagtattcca |
23878242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 121
Target Start/End: Original strand, 23421059 - 23421099
Alignment:
| Q |
81 |
caatgatttggtcactgaactacagagtattccaaaacact |
121 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| |||||| |
|
|
| T |
23421059 |
caataatttggtcactgaactgcagagtattccataacact |
23421099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University