View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11422_low_24 (Length: 251)
Name: NF11422_low_24
Description: NF11422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11422_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 16882253 - 16882024
Alignment:
| Q |
1 |
atatttcaaggtgcagtaaattttcattaaatattaatgtagaacaaatttacgacaaccataaaatgtattgatctgtaatatatgtagaaccttaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16882253 |
atatttcaaggtgcagtaaattttcattaaatattaatgtagaacaaatttacgacaactataaaatatattgatccgtaatatatgtagaaccttaata |
16882154 |
T |
 |
| Q |
101 |
ttaactctaaaagtttggtctagtggtaaaatgacatatcttaaacatggaggtttcaggttcaagccccatcattgattttgaaatgaggtaaatgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||| | |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16882153 |
ttaactctaaaagtttggtctagtggtaaaataacatatcttgaacctagaggtttcaggttcaagctccatcattgattttgaaatgaggtaaatgtaa |
16882054 |
T |
 |
| Q |
201 |
tttcctttacaggggttctctgaatcctaa |
230 |
Q |
| |
|
||||||||| || |||||||||| |||||| |
|
|
| T |
16882053 |
tttcctttatagaggttctctgagtcctaa |
16882024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 143
Target Start/End: Original strand, 24252663 - 24252695
Alignment:
| Q |
111 |
aagtttggtctagtggtaaaatgacatatctta |
143 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
24252663 |
aagtttagtctagtggtaaaatgacatatctta |
24252695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University