View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11423_low_12 (Length: 249)
Name: NF11423_low_12
Description: NF11423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11423_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 43 - 176
Target Start/End: Complemental strand, 30475909 - 30475776
Alignment:
| Q |
43 |
aatattatggaaccttattaacaactcagctaagatttggtgcaagtatttcaaaatatgattcacgaagagatgtaatgataattagcagataatacga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30475909 |
aatattatggaaccttattaacaactcagctaagatttggtgcaagtatttcaaaatatgattcacgaagagatgtgatgataattagcagataatacga |
30475810 |
T |
|
| Q |
143 |
gcagtgatgtaaaatatgatttggtgcaagtaac |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30475809 |
gcagtgatgtaaaatatgatttggtgcaagtaac |
30475776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 45
Target Start/End: Complemental strand, 30475967 - 30475928
Alignment:
| Q |
6 |
atgatggtggtctagaatttaaagaccacgtcttatgaat |
45 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30475967 |
atgatggtggtctagaatttaaagaccatgtcttatgaat |
30475928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University