View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11423_low_14 (Length: 241)
Name: NF11423_low_14
Description: NF11423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11423_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 45387923 - 45388037
Alignment:
| Q |
1 |
taatggaagtatgtggtccacatatttctaactaaaaatttcaacaatacttggttttaaatcaacggaaatctcaacaattttttattttgaacgaacg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
45387923 |
taatggaagtatgtggtccacgtatttctaactaaaaatttcaacaatacttggttttaaatcaacgg-aacctcaacaattttttattttgaacgaacg |
45388021 |
T |
 |
| Q |
101 |
ggagatttagccataa |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45388022 |
ggagatttagccataa |
45388037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 224
Target Start/End: Original strand, 45388113 - 45388149
Alignment:
| Q |
188 |
ctatattgaatgttgaatagcatgggggttaggactc |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45388113 |
ctatattaaatgttgaatagcatgggggttaggactc |
45388149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University