View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11423_low_5 (Length: 501)
Name: NF11423_low_5
Description: NF11423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11423_low_5 |
 |  |
|
| [»] scaffold0879 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 322; Significance: 0; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 123 - 484
Target Start/End: Original strand, 24421448 - 24421809
Alignment:
| Q |
123 |
atggtggaggtggagatttataataataaggtgggtatttgtggacatagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatgg |
222 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
24421448 |
atggtggaggtggagatttgtagtaataaggtgggtatttgtggacatatggaggtggtggcgatggagaaggtggaggtggggatttgtagtaatatgg |
24421547 |
T |
 |
| Q |
223 |
aggtgatttgaaatagtaaggtggctgctgtccatgacttggtggtgttggttgcggatagttgttgtttggttggccgccatagtaaggcttataatca |
322 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24421548 |
aggtgatttgaaataatatggtggctgttgtccatgacttggtggtgttggttgcggatagttgttgtttggttggccgccatagtaaggcttataatca |
24421647 |
T |
 |
| Q |
323 |
tcagcagcgacactgcttgcaattacgcaaaatgctattgcgtagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatg |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24421648 |
tcagcagcgacactgcttgcaattacgcaaaatgctattgcgtagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatg |
24421747 |
T |
 |
| Q |
423 |
tgtatttctgtactcagttccttggaagagtgatagctagttactgtgattgcttaagtttg |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24421748 |
tgtatttctgtactcagttccttggaagagtgatagctagttactgtgattgcttatgtttg |
24421809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 123 - 484
Target Start/End: Complemental strand, 24470275 - 24469914
Alignment:
| Q |
123 |
atggtggaggtggagatttataataataaggtgggtatttgtggacatagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatgg |
222 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
24470275 |
atggtggaggtggagatttgtagtaataaggtgggtatttgtggacatatggaggtggtggcgatggagaaggtggaggtggggatttgtagtaatatgg |
24470176 |
T |
 |
| Q |
223 |
aggtgatttgaaatagtaaggtggctgctgtccatgacttggtggtgttggttgcggatagttgttgtttggttggccgccatagtaaggcttataatca |
322 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24470175 |
aggtgatttgaaataatatggtggctgttgtccatgacttggtggtgttggttgcggatagttgttgtttggttggccgccatagtaaggcttataatca |
24470076 |
T |
 |
| Q |
323 |
tcagcagcgacactgcttgcaattacgcaaaatgctattgcgtagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatg |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24470075 |
tcagcagcgacactgcttgcaattacgcaaaatgctattgcgtagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatg |
24469976 |
T |
 |
| Q |
423 |
tgtatttctgtactcagttccttggaagagtgatagctagttactgtgattgcttaagtttg |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24469975 |
tgtatttctgtactcagttccttggaagagtgatagctagttactgtgattgcttatgtttg |
24469914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 365 - 484
Target Start/End: Original strand, 24477878 - 24477997
Alignment:
| Q |
365 |
tagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatgtgtatttctgtactcagttccttggaagagtgatagctagtt |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24477878 |
tagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatgtgtatttctgtactcagttccttggaagagtgatagctagtt |
24477977 |
T |
 |
| Q |
465 |
actgtgattgcttaagtttg |
484 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24477978 |
actgtgattgcttaagtttg |
24477997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 176 - 351
Target Start/End: Original strand, 24406613 - 24406780
Alignment:
| Q |
176 |
ggtggtggtgatgaagatggtggaggtggggatttgtagtaatatggaggtgatttgaaatagtaaggtggctgctgtccatgacttggtggtgttggtt |
275 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||| || ||||||||||| |||||||||||||||||| ||| |
|
|
| T |
24406613 |
ggtggtggtgatggagatggtggaggtggggtcttgtagtaatatggaggtggtttgaaataatatggtggctgctggccatgacttggtggtgttagtt |
24406712 |
T |
 |
| Q |
276 |
gcggatagttgttgtttggttggccgccatagtaaggcttataatcatcagcagcgacactgcttgcaattacgca |
351 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||||||||| | ||| | |||||||||||||| |
|
|
| T |
24406713 |
gtggatagttgttgtttgg--------catagtaaggcttataatcatcagcaacaacaatacttgcaattacgca |
24406780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 126 - 264
Target Start/End: Original strand, 24477732 - 24477870
Alignment:
| Q |
126 |
gtggaggtggagatttataataataaggtgggtatttgtggacatagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatggagg |
225 |
Q |
| |
|
||||||||||| || | || |||||||||||||||||| ||||||||||||||| |||||| |||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
24477732 |
gtggaggtggatatatgtagtaataaggtgggtatttgcagacatagggaggtggaggtgatagagatggcggaggtgggaacttgtagtaatatggagg |
24477831 |
T |
 |
| Q |
226 |
tgatttgaaatagtaaggtggctgctgtccatgacttgg |
264 |
Q |
| |
|
||||||| |||| || |||| |||||||||||||||||| |
|
|
| T |
24477832 |
tgatttggaataatatggtgcctgctgtccatgacttgg |
24477870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 166 - 232
Target Start/End: Original strand, 24482208 - 24482274
Alignment:
| Q |
166 |
gacatagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatggaggtgatttg |
232 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| ||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
24482208 |
gacataaggaggtggtggtgatggagatggtggtggtggagatttgtagtaatatggtggtaatttg |
24482274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 167 - 219
Target Start/End: Original strand, 24421423 - 24421475
Alignment:
| Q |
167 |
acatagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaata |
219 |
Q |
| |
|
||||| ||||| |||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
24421423 |
acatacggaggaggtggtgagggagatggtggaggtggagatttgtagtaata |
24421475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 167 - 219
Target Start/End: Complemental strand, 24470300 - 24470248
Alignment:
| Q |
167 |
acatagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaata |
219 |
Q |
| |
|
||||| ||||| |||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
24470300 |
acatacggaggaggtggtgagggagatggtggaggtggagatttgtagtaata |
24470248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0879 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: scaffold0879
Description:
Target: scaffold0879; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 242 - 484
Target Start/End: Complemental strand, 4416 - 4174
Alignment:
| Q |
242 |
ggtggctgctgtccatgacttggtggtgttggttgcggatagttgttgtttggttggccgccatagtaaggcttataatcatcagcagcgacactgcttg |
341 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4416 |
ggtggctgttgtccatgacttggtggtgttggttgcggatagttgttgtttggttggccgccatagtaaggcttataatcatcagcagcgacactgcttg |
4317 |
T |
 |
| Q |
342 |
caattacgcaaaatgctattgcgtagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatgtgtatttctgtactcagtt |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316 |
caattacgcaaaatgctattgcgtagatgagttgaggcaaatgcctcaacccaaatgaggttcccatcttttttaagaatgtgtatttctgtactcagtt |
4217 |
T |
 |
| Q |
442 |
ccttggaagagtgatagctagttactgtgattgcttaagtttg |
484 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4216 |
ccttggaagagtgatagctagttactgtgattgcttatgtttg |
4174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 31)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 170 - 222
Target Start/End: Complemental strand, 11905476 - 11905424
Alignment:
| Q |
170 |
tagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatgg |
222 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
11905476 |
tagggagggggtggtgatggtgatggtggtggtggagatttgtagtaatatgg |
11905424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 170 - 222
Target Start/End: Complemental strand, 11882631 - 11882579
Alignment:
| Q |
170 |
tagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatgg |
222 |
Q |
| |
|
|||||||| ||||| |||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
11882631 |
tagggagggggtggggatggtgatggtggtggtggagatttgtagtaatatgg |
11882579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888269 - 11888233
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888269 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888317 - 11888281
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888317 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888365 - 11888329
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888365 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888413 - 11888377
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888413 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888461 - 11888425
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888461 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888509 - 11888473
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888509 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888557 - 11888521
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888557 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888605 - 11888569
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888605 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888653 - 11888617
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888653 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888701 - 11888665
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888701 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888749 - 11888713
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888749 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888797 - 11888761
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888797 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888845 - 11888809
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888845 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888893 - 11888857
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888893 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888941 - 11888905
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888941 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11888989 - 11888953
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11888989 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11888953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889037 - 11889001
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889037 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889085 - 11889049
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889085 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889133 - 11889097
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889133 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889181 - 11889145
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889181 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889229 - 11889193
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889229 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889277 - 11889241
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889277 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889325 - 11889289
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889325 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889373 - 11889337
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889373 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889421 - 11889385
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889421 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889469 - 11889433
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889469 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889517 - 11889481
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889517 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 11889565 - 11889529
Alignment:
| Q |
191 |
gatggtggaggtggggatttgtagtaatatggaggtg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11889565 |
gatggtggaggtggggatttgtagtagtatggtggtg |
11889529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 170 - 222
Target Start/End: Complemental strand, 11891865 - 11891813
Alignment:
| Q |
170 |
tagggaggtggtggtgatgaagatggtggaggtggggatttgtagtaatatgg |
222 |
Q |
| |
|
|||||||| ||||| |||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
11891865 |
tagggagggggtggggatggtgatggtggtggtggagatttgtagtaatatgg |
11891813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University