View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11425_low_16 (Length: 223)
Name: NF11425_low_16
Description: NF11425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11425_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 204
Target Start/End: Original strand, 41094014 - 41094204
Alignment:
| Q |
14 |
caaaggaacggaaagaattgtgatccgaagctaaggtaattcaactatggagtctctagactcgtttgaggaagagcagtcacatcatcaatctccaacc |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094014 |
caaaggaacagaaagaattgtgatccgaagctaaggtaattcaactatggagtctctagactcgtttgaggaagagcagtcacatcatcaatctccaacc |
41094113 |
T |
|
| Q |
114 |
actggtggaggaggaggagtagtagtaggaggaccttttgaagatgacaataatagtaactatgaaggattcaattctcaacagcagtttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094114 |
actggtggaggaggaggagtagtagtaggaggaccttttgaagatgacaacaatagtaactatgaaggattcaattctcaacagcagtttg |
41094204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University