View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11425_low_5 (Length: 359)
Name: NF11425_low_5
Description: NF11425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11425_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 12 - 342
Target Start/End: Original strand, 14812285 - 14812615
Alignment:
| Q |
12 |
agaagaagaagatgaagatgatgatgagtttacatttgttttcgcagatcctaaaggttcaccgatttccgctgacgatgtgttcgataaaggtcagatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14812285 |
agaagaagaagatgaagatgatgatgagtttacatttgttttcgcagatcctaaaggttcaccgatttccgctgacgatgtgttcgataaaggtcagatt |
14812384 |
T |
|
| Q |
112 |
cgtccgannnnnnnnnnnnncggtcaggatcttcatttcaccgacgattacgataatgaatctggaaaccgttcaccggtgaggaaatttttcgtcgaat |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14812385 |
cgtccgatttttccttttttcggtcaggatcttcatttcaccgacgattacgataatgaatctggaaaccgttcaccggtgaggaaatttttcgtggaat |
14812484 |
T |
|
| Q |
212 |
caccgtcttcgtcgaagacagcgacgagttctgcggcggtggaaggaacttactgcgagtggaatccnnnnnnngcggtgaagagtaattcaacaggatc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14812485 |
caccgtcttcgtcgaagacagcgacgagttctgcggcggtggaaggaacttactgcgagtggaatccaaaaaaagcggtgaagagtaattcaacaggatc |
14812584 |
T |
|
| Q |
312 |
atcaaaactatggaagttacgagatccaaag |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14812585 |
atcaaaactatggaagttacgagatccaaag |
14812615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University