View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11425_low_8 (Length: 340)
Name: NF11425_low_8
Description: NF11425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11425_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 17 - 328
Target Start/End: Complemental strand, 27191004 - 27190693
Alignment:
| Q |
17 |
gttttatcagcaattgggctttttgaagcccaattaagtagtagtgcttatcaagttttgggtatggctgaaattggaattttgccaaaggtttgtggag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
27191004 |
gttttatcagcaattgggctttttgaagcccaattaagtagtagtgcttatcaagttttgggtatggctgaaattggaattttgcccaagttttgtggag |
27190905 |
T |
 |
| Q |
117 |
ttaggtcaaaatggtttaatacaccttggttgggtattttggtatctactttgataacaattggtgtttcttatatggatttcactgatataatttcatc |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27190904 |
tgaggtcaaaatggtttaatacaccttggttgggtattttggtatctactttgataacaattggtgtttcttatatggatttcactgatataatttcatc |
27190805 |
T |
 |
| Q |
217 |
agctaattttttgtatagtttgggtatgatattggaatttgcttcttttctttggttgagatggaagaagccaatgttagtgagaccttataagattcca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27190804 |
agctaattttttgtatagtttgggtatgatattggaatttgcttcttttctttggttgagatggaagaagccaatgttagtgagaccttataagattcca |
27190705 |
T |
 |
| Q |
317 |
atgaatttgcct |
328 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27190704 |
atgaatttgcct |
27190693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University