View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_high_28 (Length: 352)
Name: NF11426_high_28
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 12 - 180
Target Start/End: Complemental strand, 47179726 - 47179557
Alignment:
| Q |
12 |
aatatcctcgcagattatccttaatcgacaggccaaggcacttaaacgggaccttatgtagcttgcacttgttgattattattattatttggtgaaataa |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47179726 |
aatatcctcacagattatccttaatcgacaggccaaggcacttaaacgggaccttatgtagcttgcacttgttgatttttattattatttggtgaaataa |
47179627 |
T |
 |
| Q |
112 |
ttgc-acatttaacttcaaagttatttttaaggatttattaaggctcgtcgagggttgttttatgtcttg |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47179626 |
ttgcaacatttaacttcaaagttatttttaaggatttattaaggctcgtcgagggttgttttatgtcttg |
47179557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 241 - 345
Target Start/End: Complemental strand, 47179496 - 47179392
Alignment:
| Q |
241 |
ccagatttagtggtggtctagctgatgatcagaggtggatgaagtggtgaacaatgatggttagaggttgtaggagtggttatcgggtggtggtccgtgt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||| |
|
|
| T |
47179496 |
ccagatttagtggtggtctagctgatgatcagaggtggatgaagtggtgaacaatgatggttagaggtggtaggagtggttatcgggtggtgatatgtgt |
47179397 |
T |
 |
| Q |
341 |
gtttg |
345 |
Q |
| |
|
||||| |
|
|
| T |
47179396 |
gtttg |
47179392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University