View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_high_41 (Length: 266)
Name: NF11426_high_41
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 5139332 - 5139098
Alignment:
| Q |
17 |
aagaagcgggatcctggtgtttggatgaaggataggtggtgggagctcccacttgagtggaaaattgtttgatttaatgtgtgattagttaagcctcatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139332 |
aagaagcgggatcctggtgtttggatgaaggataggtggtgggagctcacacttgagtggaaaattgtttgatttaatgtgtgattagttaagcctcata |
5139233 |
T |
 |
| Q |
117 |
tacctcttaatgtcttaaatattttgatttctccttctcttatagttttgaaacattaactcgttgtcttttctatcgctcccccagactcccgaataat |
216 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139232 |
tacctcttaatgtcttaaatgttttgatttctccttctcttatagttctgaaacattaactcgttgtcttttctatcgctcccccagactcccgaataat |
5139133 |
T |
 |
| Q |
217 |
gaatcaccgttaaatgatagtgtcctcaacatgtt |
251 |
Q |
| |
|
||| |||| |||| |||||||||||||||||||| |
|
|
| T |
5139132 |
taattaccgctaaacgatagtgtcctcaacatgtt |
5139098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University