View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_high_48 (Length: 246)
Name: NF11426_high_48
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 51 - 134
Target Start/End: Complemental strand, 12032848 - 12032765
Alignment:
| Q |
51 |
tatatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
134 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12032848 |
tatatgggattatgctaaaaatagattaggtttacctctttttaggttttgttatccttgagggtcaggttcttgtcccccctc |
12032765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 51 - 134
Target Start/End: Original strand, 14636839 - 14636921
Alignment:
| Q |
51 |
tatatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
134 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14636839 |
tatatgggattatgctataaatag-ttgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
14636921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 158 - 197
Target Start/End: Complemental strand, 12032741 - 12032702
Alignment:
| Q |
158 |
attatcaatctaatgggacttgtctgttgacaagtttcct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12032741 |
attatcaatctaatgggacttgtctgttgacaagtttcct |
12032702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 12032906 - 12032873
Alignment:
| Q |
16 |
cagacattggcttttctattcaatctcaattttg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12032906 |
cagacattggcttttctattcaatctcaattttg |
12032873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 14636781 - 14636816
Alignment:
| Q |
16 |
cagacattggcttttctattcaatctcaattttggt |
51 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14636781 |
cagacattggtttttctattcaatctcaattttggt |
14636816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 53 - 134
Target Start/End: Complemental strand, 8294962 - 8294881
Alignment:
| Q |
53 |
tatgggattatgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
134 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
8294962 |
tatgggactttgctagaaatagattgggtttacctctttttaggttttgttagccttaagggtcaggtgcttgtcccccctc |
8294881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 63 - 132
Target Start/End: Original strand, 27727847 - 27727916
Alignment:
| Q |
63 |
tgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccc |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
27727847 |
tgctagaaatagattgggtttacctatttttaggttttgttagccttgagggtcaggtgcttgtcccccc |
27727916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 63 - 134
Target Start/End: Complemental strand, 22162122 - 22162051
Alignment:
| Q |
63 |
tgctagaaatagattgggtttacctctttttaggttttgttaaccttgagggtcaggttcttgtcccccctc |
134 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
22162122 |
tgctagaaatagattgggtttacctatttttaggttttgttagccttgagggtcaggtgcttgtcccccctc |
22162051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University