View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_high_51 (Length: 241)
Name: NF11426_high_51
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 27168577 - 27168797
Alignment:
| Q |
4 |
gaaaatgttgaggcgaattgtgatttttcgactcttgatcatgttctagatatgattcctggtgttaagagaatgatcatgggacataagattcagaaga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27168577 |
gaaaatgttgaggcgaattgtgatttttcgattcttgatcatgttctagatatgattcctggtgttaagagaatgatcatgggacataagattcagaaga |
27168676 |
T |
 |
| Q |
104 |
atgggattaacggcgtttgggatagcaaggctattcgaatcgatgtcggtatgtcgaaaagatgtggtggtgctttgcctgaagttttggagattaatga |
203 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27168677 |
atgggattaacggcgtttgggataacaaggctattcgaatcgatgtcggtatgtcgaaaagatgtcatggtgctttgcctgaagttttggagattaatga |
27168776 |
T |
 |
| Q |
204 |
gacttctggattgaggatatt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27168777 |
gacttctggattgaggatatt |
27168797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 484887 - 485067
Alignment:
| Q |
18 |
gaattgtgatttttcgactcttgatcatgttctagatatgattcctggtgttaagagaatgatcatgggacataagattcagaagaatgggattaacggc |
117 |
Q |
| |
|
||||||||||| ||||| |||||| |||||| | | |||||||||||||||||| ||||| ||||| |||| |||||||||| | |||||||| || |
|
|
| T |
484887 |
gaattgtgattgttcgagtcttgagcatgttttgtcgacgattcctggtgttaagaggatgattatggggcatacgattcagaaggaagggattaatggt |
484986 |
T |
 |
| Q |
118 |
gtttgggatagcaaggctattcgaatcgatgtcggtatgtcgaaaagatgtggtggtgctttgcctgaagttttggagatt |
198 |
Q |
| |
|
|| || || | ||||| ||| | || ||||| |||||||| ||| |||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
484987 |
gtctgcgaaaataaggcgattaggattgatgttggtatgtcaaaaggatgcggtggtggtttgcctgaggttttggagatt |
485067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University