View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11426_high_51 (Length: 241)

Name: NF11426_high_51
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11426_high_51
NF11426_high_51
[»] chr8 (1 HSPs)
chr8 (4-224)||(27168577-27168797)
[»] chr7 (1 HSPs)
chr7 (18-198)||(484887-485067)


Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 27168577 - 27168797
Alignment:
4 gaaaatgttgaggcgaattgtgatttttcgactcttgatcatgttctagatatgattcctggtgttaagagaatgatcatgggacataagattcagaaga 103  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27168577 gaaaatgttgaggcgaattgtgatttttcgattcttgatcatgttctagatatgattcctggtgttaagagaatgatcatgggacataagattcagaaga 27168676  T
104 atgggattaacggcgtttgggatagcaaggctattcgaatcgatgtcggtatgtcgaaaagatgtggtggtgctttgcctgaagttttggagattaatga 203  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||    
27168677 atgggattaacggcgtttgggataacaaggctattcgaatcgatgtcggtatgtcgaaaagatgtcatggtgctttgcctgaagttttggagattaatga 27168776  T
204 gacttctggattgaggatatt 224  Q
    |||||||||||||||||||||    
27168777 gacttctggattgaggatatt 27168797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 484887 - 485067
Alignment:
18 gaattgtgatttttcgactcttgatcatgttctagatatgattcctggtgttaagagaatgatcatgggacataagattcagaagaatgggattaacggc 117  Q
    ||||||||||| ||||| |||||| |||||| |    | |||||||||||||||||| ||||| ||||| |||| |||||||||| | |||||||| ||     
484887 gaattgtgattgttcgagtcttgagcatgttttgtcgacgattcctggtgttaagaggatgattatggggcatacgattcagaaggaagggattaatggt 484986  T
118 gtttgggatagcaaggctattcgaatcgatgtcggtatgtcgaaaagatgtggtggtgctttgcctgaagttttggagatt 198  Q
    || || || |  ||||| ||| | || ||||| |||||||| ||| |||| ||||||| ||||||||| ||||||||||||    
484987 gtctgcgaaaataaggcgattaggattgatgttggtatgtcaaaaggatgcggtggtggtttgcctgaggttttggagatt 485067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University